Disclaimer: I am not a financial advisor. This entire post represents my personal views and opinions, and should not be taken as financial advice (or advice of any kind whatsoever). I encourage you to do your own research, take anything I write with a grain of salt, and hold me accountable for any mistakes you may catch. Also, full disclosure, I hold a net long position in GME, but my cost basis is very low (average ~$67--I have to admit, the drop today was too tasty so my cost basis went up from yesterday)/share with my later buys averaged in), and I'm using money I can absolutely lose. My capital at risk and tolerance for risk generally is likely substantially different than yours. In this post I will go a little further and speculate more than I'd normally do in a post due to the questions I've been getting, so fair warning, some of it might be very wrong. I suspect we'll learn some of the truth years from now when some investigative journalist writes a book about it.
Thank you everyone for the comments and questions on the first and second post on this topic.
Today was a study in the power of fear, courage, and the levers you can pull when you wield billions of dollars...
Woops, excuse me. I'm sorry hedge fund guys... I meant trillions of dollars--I just briefly forget you control not just your own but a lot of other peoples' money too for a moment there.
Also, for people still trading this on market-based rationale (as I am), it was a good day to measure the conviction behind your thesis. I like to think I have conviction, but in case you are somehow not yet familiar with the legend of DFV, you need to see these posts (fair warning, nsfw, and some may be offended/triggered by the crude language). The last two posts might be impressive, but you should follow it in chronological order and pay attention to the evolution of sentiment in the comments to experience true enlightenment.
Anyway, I apologize, but this post will be very long--there's just a lot to unpack.

Pre-Market

Disclaimer: given yesterday's pre-market action I didn't even pay attention to the screen until near retail pre-market. I'm less confident in my ability to read what's going on in a historical chart vs the feel I get watching live, but I'll try.
Early in the pre-market it looks to me like some momentum traders are taking profit, discounting the probability that the short-side will give them a deep discount later, which you can reasonably assume given the strategy they ran yesterday. If they're right they can sell some small volume into the pre-market top, wait for the hedge funds try to run the price back down, and then lever up the gains even higher buying the dip. Buy-side here look to me like people FOMOing and YOLOing in at any price to grab their slice of gainz, or what looks to be market history in the making. No way are short-side hedge funds trying to cover anything at these prices.
Mark Cuban--well said! Free markets baby!
Mohamed El-Erian is money in the bank as always. "upgrade in quality" on the pandemic drop was the best, clearest actionable call while most were at peak panic, and boy did it print. Your identifying the bubble as the excessive short (vs blaming retail activity) is money yet again. Also, The PAIN TRADE (sorry, later interview segment I only have on DVR, couldn't find on youtube--maybe someone else can)!
The short attack starts, but I'm hoping no one was panicking this time--we've seen it before. Looks like the momentum guys are minting money buying the double dip into market open.
CNBC, please get a good market technician to explain the market action. Buy-side dominance, sell-side share availability evaporating into nothing (look at day-by-day volume last few days), this thing is now at runaway supercritical mass. There is no changing the trajectory unless you can change the very fabric of the market and the rules behind it (woops, I guess I should have knocked on wood there).
If you know the mechanics, what's happening in the market with GME is not mysterious AT ALL. I feel like you guys are trying to scare retail out early "for their own good" (with all sincerity, to your credit) rather than explain what's happening. Possibly you also fear that explaining it would equate to enabling/encouraging people to keep trying to do it inappropriately (possibly fair point, but at least come out and say that if that's the case). Outside the market, however...wow.

You Thought Yesterday Was Fear? THIS is Fear!

Ok short-side people, my hat is off to you. Just when I thought shouting fire in a locked theater was fear mongering poetry in motion, you went and took it to 11. What's even better? Yelling fire in a theater with only one exit. That way people can cause the financial equivalent of stampede casualties. Absolutely brilliant.
Robin Hood disables buying of GME, AMC, and a few of the other WSB favorites. Other brokerages do the same. Even for people on 0% margin. Man, and here I thought I had seen it all yesterday.
Side note: I will give a shout out to TD Ameritrade. You guys got erroneously lumped together with RH during an early CNBC segment, but you telegraphed the volatility risk management changes and gradually ramped up margin requirements over the past week. No one on your platform should have been surprised if they were paying attention. And you didn't stop anyone from trading their own money at any point in time. My account balance thanks you. I heard others may have had problems, but I'll give you the benefit of the doubt given the DDOS attacks that were flyiing around
Robin Hood. Seriously WTF. I'm sure it was TOTALLY coincidence that your big announcements happen almost precisely when what has to be one of the best and most aggressive short ladder attacks of all time starts painting the tape, what looked like a DDOS attack on Reddit's CDN infrastructure (pretty certain it was the CDN because other stuff got taken out at the same time too), and a flood of bots hit social media (ok, short-side, this last one is getting old).
Taking out a large-scale cloud CDN is real big boy stuff though, so I wouldn't entirely rule out nation state type action--those guys are good at sniffing out opportunities to foment social unrest.
Anyway, at this point, as the market dives, I have to admit I was worried for a moment. Not that somehow the short-side would win (hah! the long-side whales in the pond know what's up), but that a lot of retail would get hurt in the action. That concern subsided quite a bit on the third halt on that slide. But first...
A side lesson on market orders
Someone printed bonus bank big time (and someone lost--I feel your pain, whoever you are).
During the face-ripping volatility my play money account briefly ascended to rarified heights of 7 figures. It took me a second to realize it, then another second to process it. Then, as soon as it clicked, that one, glorious moment in time was gone.
What happened?
During the insane chop of the short ladder attack, someone decided to sweep the 29 Jan 21 115 Call contracts, but they couldn't get a grip on the price, which was going coast to coast as IV blew up and the price was being slammed around. So whoever was trying to buy said "F it, MARKET ORDER" (i.e. buy up to $X,XXX,XXX worth of contracts at any price). This is referred to as a sweep if funded to buy all/most of the contracts on offer (HFT shops snipe every contract at each specific price with a shotgun of limit orders, which is far safer, but something only near-market compute resources can do really well). For retail, or old-tech pros, if you want all the contracts quickly, you drop a market order loaded with big bucks and see what you get... BUT, some clever shark had contracts available for the reasonable sum of... $4,400, or something around that. I was too stunned to grab a screencap. The buy market order swept the book clean and ran right into that glorious, nigh-obscene backstop limit. So someone got nearly $440,000 PER CONTRACT that was, at the time theoretically priced at around $15,000. $425,000 loss... PER CONTRACT. Maybe I'm not giving the buyer enough credit.. you can get sniped like that even if you try to do a safety check of the order book first, but, especially in low liquidity environments, if a HFT can peak into your order flow (or maybe just observes a high volume of sweeps occurring), they can end up front running your sweep, pick off the reasonable contracts, and slam a ridiculous limit sell order into place before your order makes it to the exchange. Either way, I hope that sweep wasn't loaded for bear into the millions. If so... OUCH. Someone got cleaned out.
So, the lesson here folks... in a super high volatility, low-liquidity market, a market order will just run up the ladder into the first sell order it can find, and some very brutal people will put limit sells like that out there just in case they hit the jackpot. And someone did. If you're on the winning side, great. It can basically bankrupt you if you're on the losing side. My recommendation: Just don't try it. I wouldn't be surprised if really shady shenanigans were involved in this, but no way to know (normally that's crazy-type talk, but after today....peeking at order flow and sniping sweeps is one of the fastest, most financially devastating ways to bleed big long-side players, just sayin').
edit *so while I was too busy trying not to spit out my coffee to grab a screenshot, piddlesthethug was faster on the draw and captured this: https://imgur.com/gallery/RI1WOuu
Ok, so I guess my in-the-moment mental math was off by about 10%. Man, that hurts just thinking about the guy who lost on that trade.*
Back to the market action..

A Ray of Light Through the Darkness

So I was worried watching the crazy downward movement for two different reasons.
On the one hand, I was worried the momentum pros would get the best discounts on the dip (I'll admit, I FOMO'd in too early, unnecessarily raising my cost basis).
On the other hand, I was worried for the retail people on Robin Hood who might be bailing out into incredibly steep losses because they had only two options: Watch the slide, or bail. All while dealing with what looked to me like a broad-based cloud CDN outage as they tried to get info from WSB HQ, and wondering if the insta-flood of bot messages were actually real people this time, and that everyone else was bailing on them to leave them holding the bag.
But I saw the retail flag flying high on the 3rd market halt (IIRC), and I knew most would be ok. What did I see, you ask? Why, the glorious $211.00 / $5,000 bid/ask spread. WSB Reddit is down? Those crazy mofos give you the finger right on the ticker tape. I've been asked many times in the last few hours about why I was so sure shorts weren't covering on the down move. THIS is how I knew. For sure. It's in the market data itself.
edit So, there's feedback in the comments that this is likely more of a technical glitch. Man, at least it was hilarious in the moment. But also now I know maybe not to trust price updates when the spread between orders being posted is so wide. Maybe a technical limitation of TOS
I'll admit, I tried to one-up those bros with a 4206.90 limit sell order, but it never made it through. I'm impressed that the HFT guys at the hedge fund must have realized really quickly what a morale booster that kind of thing would have been, and kept a lower backstop ask in place almost continuously from then on I'm sure others tried the same thing. Occasionally $1,000 and other high-dollar asks would peak through from time to time from then on, which told me the long-side HFTs were probably successfully sniping the backstops regularly.
So, translating for those of you who found that confusing. First, such a high ask is basically a FU to the short-side (who, as you remember, need to eventually buy shares to cover their short positions). More importantly, as an indicator of retail sentiment, it meant that NO ONE ELSE WAS TRYING TO SELL AT ANY PRICE LOWER THAN $5,000. Absolutely no one was bailing out.
I laughed for a minute, then started getting a little worried. Holy cow.. NO retail selling into the fear? How are they resisting that kind of price move??
The answer, as we all know now... they weren't afraid... they weren't even worried. They were F*CKING PISSED.
Meanwhile the momentum guys and long-side HFTs keep gobbling up the generously donated shares that the short-side are plowing into their ladder attack. Lots of HFT duels going on as long-side HFTs try to intercept shares meant to travel between short-side HFT accounts for their ladder. You can tell when you see prices like $227.0001 constantly flying across the tape. Retail can't even attempt to enter an order like that--those are for the big boys with privileged low-latency access.
The fact that you can even see that on the tape with human eyes is really bad for the short-side people.
Why, you ask? Because it means liquidity is drying up, and fast.

The Liquidity Tide is Flowing Out Quickly. Who's Naked (short)?

Market technicals time. I still wish this sub would allow pictures so I could throw up a chart, but I guess a table will do fine.
​

Date	Volume	Price at US Market Close
Friday, 1/22/21	197,157,196	$65.01
Monday, 1/25/21	177,874,00	$76.79
Tuesday, 1/26/21	178,587,974	$147.98
Wednesday, 1/27/21	93,396,666	$347.51
Thursday, 1/28/21	58,815,805	$193.60

What do I see? I see the shares available to trade dropping so fast that all the near-exchange compute power in the world won't let the short-side HFTs maintain order flow volume for their attacks. Many retail people asking me questions thought today was the heaviest trading. Nope--it was just the craziest.
What about the price dropping on Thursday? Is that a sign that the short-side pulled a miracle out and pushed price down against a parabolic move on even less volume than Wednesday? Is the long side running out of capital?
Nope. It means the short-side hedge funds are just about finished.
But wait, I thought the price needed to be higher for them to be taken out? How is it that price being lower is bad for them? Won't that allow them to cover at a lower price?
No, the volume is so low that they can't cover any meaningful fraction of their position without spiking the price parabolic almost instantly. Just not enough shares on offer at reasonable prices (especially when WSB keeps flashing you 6942.00s).
It's true, a higher price hurts, but the interest charge for one more day is just noise at this point. The only tick that will REALLY count is the last tick of trading on Friday.
In the meantime, the price drop (and watching the sparring in real time) tells me that the long-side whales and their HFT quants are so certain of the squeeze that they're no longer worried AT ALL about whether it will happen, and they aren't even worried at all about retail morale to help carry the water anymore.
Instead, they're now really, really worried about how CHEAPLY they can make it happen.
They are wondering if they can't edge out just a sliver more alpha out of what will already be a blow-out trade for the history books (probably). You see, to make it happen they just have to keep hoovering up shares. It doesn't matter what those shares cost. If you're certain that the squeeze is now locked in, why push the price up and pay more than you have to? Just keep pressing hard enough to force short-side to keep sending those tasty shares your way, but not so much you move the price. Short-side realizes this and doesn't try to drive price down too aggressively. They can't afford to let price run away, so they have to keep some pressure on at the lowest volume they can manage, but they don't want to push down too hard and give the long-side HFTs too deep of a discount and bleed their ammo out even faster. That dynamic keeps price within a narrow (for GME today, anyway) trading range for the rest of the day into the close.
Good plan guys, but those after market people are pushing the price up again. Damnit WSB bros and Euros, you're costing those poor long-side whales their extra 0.0000001% of alpha on this trade just so you can run up your green rockets... See, that's the kind of nonsense that just validates Lee Cooperman's concerns.
On a totally unrelated note, I have to say that I appreciate the shift in CNBC's reporting. Much more thoughtful and informed. Just please get a good market technician in there who will be willing to talk about what is going on under the hood if possible. A lot of people watching on the sidelines are far more terrified than they need to be because it all looks random to them. And they're worried that you guys look confused and worried--and if the experts on the news are worried....??!
You should be able to find one who has access to the really good data that we retailers can only guess at, who can explain it to us unwashed masses.

Ok, So.. Questions

There is no market justification for this. How can you tell me is this fundamentally sound and not just straight throwing money away irresponsibly?? (side note: not that that should matter--if you want to throw your money away why shouldn't you be allowed to?)
We're not trading in your securities pricing model. This isn't irrational just because your model says long and short positions are the same thing. The model is not a real market. There is asymmetrical counterparty risk here given the shorts are on the hook for all the money they have, and possibly all the money their brokers have, and possibly anyone with exposure to the broker too! You may want people to trade by the rules you want them to follow. But the rest of us trade in the real market as it is actually implemented. Remember? That's what you tell the retailers who take their accounts to zero. Remember what you told the KBIO short-squeezed people? They had fair warning that short positions carry infinite risk, including more than your initial investment. You guys know this. It's literally part of your job to know this.
But-but-the systemic risk!! This is Madness!
...Madness?
THIS. IS. THE MARKET!!! *Retail kicks the short-side hedge funds down an infinity loss black hole\*.
Ok, seriously though, that is actually a fundamentally sound, and properly profit-driven answer at least as justifiable as the hedge funds' justification for going >100% of float short. If they can be allowed to gamble INFINITE LOSSES because they expect to make profit on the possibility the company goes bankrupt, can't others do the inverse on the possibility the company I don't know.. doesn't go bankrupt and gets a better strategy from the team that created what is now a $43bn market cap company (CHWY) that does exactly some of the things GME needs to do (digital revenue growth) maybe? I mean, I first bought in on that fundamental value thesis in the 30s and then upped my cost basis given the asymmetry of risk in the technical analysis as an obvious no-brainer momentum trade. The squeeze is just, as WSB people might say, tendies raining down from on high as an added bonus.
I get that you disagree on the fundamental viability of GME. Great. Isn't that what makes a market?
Regarding the consequences of a squeeze, in practice my expectation was maybe at worst some kind of ex-market settlement after liquidation of the funds with exposure to keep things nice and orderly for the rest of the market. I mean, they handled the VW thing somehow right? I see now that I just underestimated elite hedge fund managers though--those guys are so hardcore (I'll explain why I think so a bit lower down).
If hedge fund people are so hardcore, how did the retail long side ever have a chance of winning this squeeze trade they're talking about?
Because it's an asymmetrical battle once you have short interest cornered. And the risk is also crazily asymmetrical in favor of the long side if short interest is what it is in GME. In fact, the hedge funds essentially cornered themselves without anyone even doing anything. They just dug themselves right in there. Kind of impressive really, in a weird way.
What does the short side need to cover? They need the price to be low, and they need to buy shares.
How does price move lower? You have to push share volume such that supply overwhelms demand and price therefore goes down (man, I knew econ 101 would come in handy someday).
But wait... if you have to sell shares to push the price down.. won't you just undo all your work when you have to buy it back to actually cover?
The trick is you have to push price down so hard, so fast, so unpredictably, that you SCARE OTHER PEOPLE into selling their shares too, because they're scared of taking losses. Their sales help push the price down for free! and then you scoop them up at discount price! Also, there are ways to make people scared other than price movement and fear of losses, when you get right down to it. So, you know, you just need to get really, really, really good at making people scared. Remember to add a line item to your budget to make sure you can really do it right.
On the other hand..
What does the long side need to do? They need to own as much of the shares as they can get their hands on. And then they need to hold on to them. They can't be weak hands either. They need to be hands that will hold even under the most intense heat of battle, and the immense pressure of mind-numbing fear... they need to be as if they were made of... diamond... (oh wow, maybe those WSB people kind of have a point here).
Why does this matter? Because at some point the sell side will eventually run out of shares to borrow. They simply won't be there, because they'll be safely tucked away in the long-side's accounts. Once you run out of shares to borrow and sell, you have no way to move the price anymore. You can't just drop a fat stack--excuse me, I mean suitcase (we're talking hedge fund money here after all)--of Benjamins on the ticker tape directly. Only shares. No more shares, no way to have any direct effect on the price whatsoever.
Ok, doesn't that just mean trading stops? Can't you just out-wait the long side then?
Well, you could.. until someone on the long side puts 1 share up on a 69420 ask, and an even crazier person actually buys at that price on the last tick on a Friday. Let's just say it gets really bad at that point.
Ok.. but how do the retail people actually get paid?
Well, to be quite honest, it's entirely up to each of them individually. You've seen the volumes being thrown around the past week+. I guarantee you every single retailer out there could have printed money multiple times trading that flow. If they choose to, and time it well. Or they could lose it all--this is the market. Some of them apparently seem to have some plan, or an implicit trust in certain individuals to help them know when to punch out. Maybe it works out, but maybe not. There will be financial casualties on the field for sure--this is the bare-knuckled capitalist jungle after all, remember? But everyone ponied up to the table with their own money somehow, so they all get to play in the big leagues just like everyone else. In theory, anyway.
And now, Probably the #1 question I've been asked on all of these posts has been: So what happens next? Do we get the infinity squeeze? Do the hedge funds go down?
Great questions. I don't know. No one does. That's what I've said every time, but I get that's a frustrating answer, so I'll write a bit more and speculate further. Please again understand these are my opinions with a degree of speculation I wouldn't normally put in a post.

The Market and the Economy. Main Street, Wall Street, and Washington

The pandemic has hurt so many people that it's hard to comprehend. Honestly, I don't even pretend to be able to. I have been crazy fortunate enough to almost not be affected at all. Honestly, it is a little unnerving to me how great the disconnect is between people who are doing fine (or better than fine, looking at my IRA) versus the people who are on the opposite side of the ever-widening divide that, let's be honest, has been growing wider since long before the pandemic.
People on the other side--who have been told they cannot work even if they want to, who wonder if congress will get it together to at least keep them from getting thrown out of their house if they have to keep taking one for the team for the good of all, are wondering if they're even living in the same reality.
Because all they see on the news each day is that the stock market is at record highs, or some amazing tech stocks have 10x'd in the last 6 months. How can that be happening during a pandemic? Because The Market is not The Economy. The Market looks forward to that brighter future that Economy types just need to wait for. Don't worry--it'll be here sometime before the end of the year. We think. We're making money on that assumption right now, anyway. Oh, by the way, if you're in The Market, you get to get richer as a minor, unearned side-effect of the solutions our governments have come up with to fight the pandemic.
Wow. That sounds amazing. How do I get to part of that world?
Retail fintech, baby. Physical assets like real estate might be a bit out of reach at the moment, but stocks will do. I can even buy fractional shares of BRK/A LOL.
Finally, I can trade for my own slice of heaven, watching that balance go up (and up--go stonks!!). Now I too get to dream the dream. I get to feel connected to that mythical world, The Market, rather than being stuck in the plain old Economy. Sure, I might blow up my account, but that's because it's the jungle. Bare-knuckled, big league capitalism going on right here, and at least I get to show up an put my shares on the table with everyone else. At least I'm playing the same game. Everyone has to start somewhere--at least now I get to start, even if I have to learn my lesson by zeroing my account a few times. I've basically had to deal with what felt like my life zeroing out a few times before. This is number on a screen going to 0 is nothing.
Laugh or cry, right? I'll post my losses on WSB and at least get some laughs.
Geez, some of the people here are making bank. I better learn from them and see if they'll let me in on their trades. Wow... this actually might work. I don't understand yet, but I trust these guys telling me to hold onto this crazy trade. I don't understand it, but all the memes say it's going to be big.
...WOW... I can pay off my credit card with this number. Do I punch out now? No? Hold?... Ok, getting nervous watching the number go down but I trust you freaks. We're still in the jungle, but at least I'm in with with my posse now. Market open tomorrow--we ride the rocket baby! And if it goes down, at least I'm going down with my crew. At least if that happens the memes will be so hilarious I'll forget to cry.
Wow.. I can't believe it... we might actually pull this off. Laugh at us now, "pros"!
We're in The Market now, and Market rules tell us what is going to happen. We're getting all that hedge fund money Right? Right?
Maybe.
First, I say maybe because nothing is ever guaranteed until it clears. Secondly, because the rules of The Market are not as perfectly enforced as we would like to assume. We are also finding out they may not be perfectly fair. The Market most experts are willing to talk about is really more like the ideal The Market is supposed to be. This is the version of the market I make my trading decisions in. However, the Real Market gets strange and unpredictable at the edges, when things are taken to extremes, or rules are pushed beyond the breaking point, or some of the mechanics deep in the guts of the Real Market get stretched. GME ticks basically all of those boxes, which is why so many people are getting nervous (aside from the crazy money they might lose). It's also important to remember that the sheer amount of money flowing through the market has distorting power unto itself. Because it's money, and people really, really, really like their money--especially when they're used to having a lot of it, and rules involving that kind of money tend to look more... flexible, shall we say.
Ok, back to GME. If this situation with GME is allowed to play out to its conclusion in The Market, we'll see what happens. I think all the long-side people get the chance to be paid (what, I'm not sure--and remember, you have to actually sell your position at some point or it's all still just numbers on your screen), but no one knows for certain.
But this might legitimately get so big that it spills out of The Market and back into The Economy.
Geez, and here I thought the point of all of this was so that we all get to make so much money we wouldn't ever have to think and worry about that thing again.
Unfortunately, while he's kind of a buzzkill, Thomas Petterfy has a point. This could be a serious problem.
It might blow out The Market, which will definitely crap on The Economy, which as we all know from hard experience, will seriously crush Main Street.
If it's that big a deal, we may even need Washington to be involved. Once that happens, who knows what to expect.. this kind of scenario being possible is why I've been saying I have no idea how this ends, and no one else does either.
How did we end up in this ridiculous situation? From GAMESTOP?? And it's not Retail's fault the situation is what it is.. why is everyone telling US that we need to back down to save The Market?? What about the short-side hedge funds that slammed that risk into the system to begin with?? We're just playing by the rules of The Market!!
Well, here are my thoughts, opinions, and some even further speculation... This may be total fantasy land stuff here, but since I keep getting asked I'll share anyway. Just keep that disclaimer in mind.

A Study in Big Finance Power Moves: If you owe the bank $10,000, it's your problem...

What happens when you owe money you have no way to pay back? It's a scary question to have to face personally. Still, on balance and on average, if you're fortunate enough to have access to credit the borrowing is a risk that is worth taking (especially if you're reasonably careful). Lenders can take a risk loaning you money, you take a risk by borrowing in order to do something now that you would otherwise have had to wait a long time or maybe would never have realistically been able to do otherwise. Sometimes it doesn't work out. Sometimes it's due to reasons totally beyond your control. In any case, if you find yourself there you have no choice but to dust yourself off, pick yourself up as best as you can, and try to move on and rebuild. A lot of people had to learn that in 2008. Man that year really sucked.
Wall street learned their lessons too. Most learned what I think most of us would consider the right lessons--lessons about risk management, and the need to guard vigilantly against systemic risk, concentration of risk through excess concentration of leverage on common assets, etc. Many suspect that at least a few others may have learned an entirely different set of, shall we say, unhealthy lessons. Also, to try to be completely fair, maybe managing other peoples' money on 10x+ leverage comes with a kind of pressure that just clouds your judgement. I could actually, genuinely buy that. I know I make mistakes under pressure even when I'm trading risk capital I could totally lose with no real consequence. Whatever the motive, here's my read on what's happening:
First, remember that as much fun as WSB are making of the short-side hedge fund guys right now, those guys are smart. Scary smart. Keep that in mind.
Next, let's put ourselves in their shoes.
If you're a high-alpha hedge fund manager slinging trades on a $20bn 10x leveraged to 200bn portfolio, get caught in a bad situation, and are down mark-to-market several hundred million.. what do you do? Do you take your losses and try again next time? Hell no.
You're elite. You don't realize losses--you double down--you can still save this trade no sweat.
But what if that doesn't work out so well and you're in the hole >$2bn? Obvious double down. Need you ask? I'm net up on the rest of my positions (of course), and the momentum when this thing makes its mean reversion move will be so hot you can almost taste the alpha from here. Speaking of momentum, imagine the move if your friends on TV start hyping the story harder! Genius!
Ok, so that still didn't work... this is now a frigging 7 sigma departure from your modeled risk, and you're now locked into a situation that is about as close to mathematically impossible to escape as you can get in the real world, and quickly converging on infinite downside. Holy crap. The fund might be liquidated by your prime broker by tomorrow morning--and man, even the broker is freaking out. F'in Elon Musk and his twitter! You're cancelling your advance booking on his rocket ship to Mars first thing tomorrow... Ok, focus--this might legit impact your total annual return. You need a plan, and you know the smartest people on the planet, right? The masters of the universe! Awesome--they've even seen this kind of thing before and still have the playbook!! Of course! It's obvious now--you borrow a few more billion and double down again first thing in the morning. So simple. Sticky note that Mars trip cancellation so you don't forget.
Ok... so that didn't work? You even cashed in some pretty heavy chits too. Ah well, that was a long shot anyway. So where were you? Oh yeah.. if shenanigans don't work, skip to page 10...
...Which says, of course, to double down again. Anyone even keeping track anymore? Oh, S3 says it's $40bn and we're going parabolic? Man, that chart gives me goosebumps. All according to plan...
So what happens tomorrow? One possible outcome of PURE FANTASTIC SPECULATION...
End of the week--phew. Never though it'd come. Where are you at now?... Over $9000^\)!!! Wow. You did it boys, and as a bonus the memes will be so sweet.
^\)side note: add 8 zeros to the end...
Awesome--your problems have been solved. Because...
​
..
​
BOOM
​
Now it's EVERYONE's problem. Come at me, Chamath, THIS is REAL baller shit.
Now all you gotta do is make all the hysterical retirees watching their IRAs hanging in the balance blame those WSB kids. Hahaha. Boomers, amirite? hate when those kids step on their law--I mean IRAs. GG guys, keep you memes. THAT is how it's done.
Ok, but seriously, I hope that's not how it ends. I guess we just take it day by day at this point.
Apologies for the length. Good luck in the market!
Also, apologies in advance for formatting, spelling, and grammatical errors. I was typing this thing in between doing all kinds of other things for most of the day.
Edit getting a bunch of questions on if it's possible the hedge funds are finding ways to cover in spite of my assumptions. Of course. I'm a retail guy trying to read the charts and price action. I don't have any special tools like the pros may have.

Great Scott number! 88 is ready for your enjoyment. can I prevent myself from making time travel jokes? Shit...
Anywho the editors have been hard at work going through this one both past present and future so hopefully, it will resist inspection for all eternity... Okay, I'll stop... for now.
With that out of the way let's get on with the story.
ko-fi For having a pretty picture commissioned.
Sapphire
Wiki Discord
First Previous Next
__________________________________________________________________________________
Chapter 88: Speed, Power, and Teatime
Tom had managed to wriggle out of Jacky’s grasp, much to her annoyance, as he had gone to fetch his backpack, dragging it over and getting out the phone. Just for fun, he snapped a picture of Jackalope as she stared at him annoyedly, still leaning up against Jarix's side. Looking at the picture he tentatively swiped right to one of the few he had taken of Hylsdal as the others were walking around. He quickly swiped back to Jackalope. He would much rather look at that one and he had sort of promised her to at least try not to worry.
“If you would mind getting out of my armpit, then I can do a little better,” Jarix let out lazily, raising his head off the stone floor. “And you need to eat your bowl of green stuff” he continued looking to tom.
Tom grabbed Jackalope, who refused to budge. He knew that was a tug of war he wasn't winning so he stepped back pointing to Jarix then crossing his arms, shaking his head. “Fine,” Jackalope replied annoyedly before getting up.
Jarix got up doing a bit of a stretch, though judging by his face that was a rather painful experience. Then he laid down again with his two forelegs together in front of him.
“There we go, a seat fit for heroes.” To Tom’s surprise, Jackalope bowed to Jarix.
“Jackalope Furlong, you have reached the top.” She whispered far too loudly to herself, before looking up to Jarix “Thanks dude.” She went over and laid down in the crevasse between Jarix’s forelegs, leaning up against his chest. Tom had to admit it looked rather comfortable.
“Is this like a big deal?” Tom questioned, grabbing the bowl before looking up to the dragon.
“For a dragon to make you comfortable rather than itself?” Jarix asked , looking at Tom like that was the dumbest question ever.
“Didn’t think of that,” Tom had to admit before he held up the phone, stepping back to take another picture. “Smile for the camera.” Jarix did his best to put on a smile, though the result ended up looking more like a very scary reptilian golden retriever. “Goddammit that’s hilarious,” Tom chuckled at the strange sight. The smile on Jarix faded as his ears laid flat against his neck, looking rather offended.
“Oh don’t be such a diva, you just looked funny” Tom tried to console as he walked over to where Jackalope had gotten comfortable. They had been instructed to sit back and relax and so that was what they were gonna do. Tom took out the phone and started going through pictures. Jackalope craned her head over his shoulder, following along.
“Is that your home? looks big.” She questioned as he was scrolling through. He brought out the notepad to scribble something down.
“No, that is a hotel. Like a big tavern,” Tom also spoke out loud so Jarix could hear, holding up the phone for the dragon to see.
“Looks nice. How big is your house?” the dragon answered, apparently having forgiven being made fun of.
“Not big,” Tom answered as he started going through pictures.
“Wait, what’s that?” Jackalope questioned as he passed a picture with some parked cars. Tom got out the pad again.
“Driving machines.”
“But you could fly at home, right?” She responded clearly not understanding.
“That’s expensive and difficult, driving is easier.”
“But… okay… sounds slow and boring, though the quad bike was great fun.” Tom just smiled. She had another thing coming on that front. He did eventually find one of his house.
“Huh… it’s so small. but it’s not in a city right? How many do you live there?” Tom was fairly sure that had been discussed already, but this was Jackalope.
“It's in the countryside, yes, Just me,” He wrote down.
“Damn okay, Jarix look at this.” The dragon craned his head to look down at them again as Tom held up the phone. “He’s the lord of the world’s smallest keep.”
“Not to be rude,but It doesn’t look very dragon friendly. How would you even defend that?”
“You could fit in the barn I think. Would need to get creative with feeding you though. But we don’t need to defend our homes, there’s nothing around to threaten them… Well, short of other humans. But unless you want to stop an invading army by yourself there really isn't much point.”
“That sounds quite nice actually.” Jarix admitted. ‘Yeah not a hard idea to sell around here right now’ Tom thought to himself, trying not to think about yesterday.
“Yes, it’s very peaceful. Now, what was this about cars being boring?” Tom switched to looking for some of the video clips he had put on the phone way back when. ‘Oh that’s perfect’ He mused to himself as he got out the notepad again.
“This is a race with cars called Nascar. Big oval track,” He wrote down for Jackalope, trying his best to write Nascar with Draconic runes.
“So they bumble along like your four-wheeled thing in a weird circle?” Jackalope questioned as the array of colorful cars pulled out into the track. “What the…”
“What is that noise?” Jarix questioned trying to get a look, Jackalope completely enamored by what she was seeing.
“The sound of screaming engines fighting to win,” Tom replied as he let Jackalope watch.
“Shit they are going fast!” Jackalope exclaimed after a shot of the cars going past. “Wait, did you have one of these?!”
Tom put the phone on her thigh so Jarix could watch for a bit, as he scribbled away.
“Sure, not that fast, though still faster than you.” Tom felt a finger claw push slightly into his back.
“Careful now, or you might fall off the next time you can't get anywhere yourself, mister faster than me,” she replied in a playful voice. Tom just giggled as she took the claw away. “I want one though, that looks like great fun.”
“Sure you do. Give me a few decades, it might happen,” Tom noted down.
“Really!?” Jackalope let out excitedly.
“Anything for my little Jackalope.”
The finger claw came back for that one, pressing a little harder. “I’m not the little one here. Whose lap are you in right now?” She questioned with a snicker.
“Jarix’s,” Tom wrote down. The dragon let out a chuckle as Jackalope looked up at him.
“I need to get used to that” she admitted before looking back down to the phone.
“Wow what just happened!” She exclaimed as the clip cut to the obligatory crash fire and debris everywhere. “Are they okay?!” She questioned, clearly alarmed.
“I think so, cars built tough, crash all the time” Tom wrote down. Jackalope didn’t look entirely convinced, especially after the clip just cut to more racing and eventually another accident. which caused her to flinch again as the car hit the wall. This time though the driver got out and promptly proceeded to run around with his arms in the air.
That did calm her down a fair bit even cheering for the guy as he jumped up onto the car. Tom had heard a few stories about accidents from the dragonettes thus far, None of them very pretty. Hell he had even been in two technically, so he could understand her concern.
He showed them a bit more racing, even if he was a little sad he didn’t have any monster trucks on his phone. That would have been awesome. Eventually, he stumbled across a clip of a Blue Angels air show he had saved. ‘Oh, this should be good,’ he thought to himself as he scribbled on the notepad.
“Jet fighters showing off.” That certainly got Jackalope's attention, Jarix also trying hard to see what was on the screen.
“Hey they’re blue, they look fucking cool… oh that’s a lot of smoke… are they gonna do something, or are they just sitting there?” Tom didn't respond, instead letting the video play, as the angels trundled along the runway. Jackalope apparently decided to take up the role of commentator for Jarix.
“No wait, they are rolling slowly along… is that what they do?... Oh no, now, they are moving faster down a very big piece of... what is that? and… da fuck? Okay, I guess they are flying now? What the fuck! How can they do that?!” Jackalope let out as the F18 pulled into a vertical climb, afterburners lit. Tom didn’t answer, just giggling to himself. Jackalope didn’t even seem to mind taking the phone to look more closely.
“Oh look they are flying in formation… It's a bit loose though, but damn they’re fast. What’s with the smoke?”
“Just for show, and they aren't going that fast. They are just having some fun. Remember they can go faster than sound,” Tom scribbled down for her as she continued to watch the show.
“Then why not go faster?” It was a fair question, to be honest.
“Because of the boom of breaking the sound barrier. They aren’t allowed to do it near people.”
“Okay…” Jackalope replied, clearly not sure what to say to that. Jarix was just looking down at the two of them rather annoyed. Tom took Jackalope's hand and held up the phone for the dragon to see as the Angels were performing an inverted loop.
“I… can’t do that,” Jarix admitted, sounding a tad sad. “I can’t even dive that fast… and they are climbing!”
“They are quite something,” Tom responded, looking up at the dragon who was staring in awe. His eyesight must be pretty damn good too, judging by how far away from the tiny screen his head was. Not that Tom had any idea how dragon eyes worked. “That is what defends our sky back home. They fly faster than sound, they can see you and kill you, even beyond the horizon, and turn so hard the pilots pass out.” Jarix looked at Tom with a face that indicated he had quite a few questions.
“Oh look, opposing passes.” Jackalope went excitedly as the Angels continued to show off.
“We’ve got flyers incoming. Looks like the others are back,” a wounded guard shouted weakly into the hall. He appeared to have had both his wings broken in addition to a nasty face wound that had most of his head bandaged up. Looking from his current position Tom felt quite bad that he wasn’t helping out, while that guy had probably been standing guard up in the tower.
“The headcount fits?” Tom questioned as he started to squirm free of Jackalope, but she relented this time though as Tom turned off the phone. Though she did let out a rather annoyed grunt at that.
“Yup, they are all there and two extra,” came the reply.
“Lothal must be flying himself then,” Tom stated, getting up and walking over to his clothes. Even if he likely looked less scary in his underpants that just wouldn’t do even if it was nice and warm. Besides, the kids knew him, so he wouldn’t need to worry about scaring them. He had yet to see any of this keep’s children though, come to think of it.
“What’s happening?” Jackalope protested, not getting up. Tom did his best to impersonate flying, beating his arms up and down before pointing to the big door. That display caused Jackalope to snicker a bit. “You look like an idiot, you know that right?”
Tom just crossed his arms and looked at her, trying to seem as unimpressed as possible, before turning to grab his clothes from the world's most dangerous washing line. Just from gearing up and walking around, he could feel his heart still beating harder than normal, and he found himself breathing harder too. ‘This is going to suck for a while,’ he thought to himself. His dizziness had gotten a little better though, even if that was likely due to him taking it easy right now.
He helped Jackalope get her stuff on. Her ears had stopped bleeding, and she hadn’t coughed up blood for a bit. That might also just be due to not really doing anything for however long it had been now. He wiped her ears clean with a wet rag getting rid of the last encrusted blood, taking the chance to play with them a bit. They were sort of stiff but could move around a lot.
As they made ready to open that gate, Jarix turned around just in case he needed to blast the fuck out of whatever might be coming.
“Hey, Jarix? How long does it take before you're ready to shoot again by the way?” Tom went as he adjusted his shirt.
“I mean if I spent everything, half a day for a big shot... or thereabouts. I do get rather a sore in the throat too after that though.” That sounded perfectly understandable to Tom. Even if it led him to wonder what it might feel like to have lightning running through you without it hurting.
“Oh, that’s not so bad. Not sure I can help with the throat unfortunately.”
__________________________________________________________________________________
They had started the morning with another check back with the keep, but there was nothing to report. The mood at the table was a little dim as the four of them ate breakfast. Haiko poked Sapphire on the shoulder as he sat down next to her at the table. “Got a second?”
“Sure,” Sapphire responded, turning to her brother, still chewing.
“So I had a chat with some of the boys. We got no clue who we are dealing with. Not that you or Draki got much of a look at them. Are we still expecting them to come back?”
Sapphire turned back to the rest of the table, being met by blank faces. Dakota finally responded.
“We don’t know… We have tried to make ourselves an expensive target.”
“I take it that’s why you are here, sir. I must say, it is an honor to have a Royal Guard staying at our inn.”
“Hey, technically I’m at work so don’t put too much into it. I’m being paid to sleep here,” Maiko replied. He was having a laugh about it though, possibly trying to lighten the mood. He had his own room too, so he was hardly uncomfortable.
“Damn I want a job like that once,” Haiko replied, sounding a tad wistful. “Anyway, as I said, we had a chat with some people. We are gonna be getting some reinforcements at night, just in case they do come back.”
“How did you manage that?” Sapphire questioned. People didn't usually work for free after all.
“We stick together around here. If those bastards can bully one place then why not the others? It’s not gonna be much more than a few guys and girls to help scare them off.” Sapphire looked back to the table as they all nodded in approval, some smiles spreading.
“I guess we are gonna turn this place into a keep then,” Balethon joked.
“Then we just need to worry about you not getting killed coming and going,” Maiko continued, still sounding light-hearted. Dakota’s slight smile vanished at that though.
“Would they shoot us in the street you think?” She questioned, switching her gaze around the table.
“I mean, maybe?” Maiko reluctantly admitted after a bit.
“What about at Tink’s workshop? That is hardly well defended.”
“It is a guildhall but other than that no not really,” Maiko replied, clearly starting to ponder the situation. “Are we really that sure they are gonna try and kill you… and in broad daylight? I mean really?”
There was a bit of silence following that. ‘Are we being paranoid here?’ Sapphire thought to herself. What would it even cost to hire someone to try and kill them in the street? Also, there was quite the difference between a mercenary group and an assassin “Don't you think they are just trying to scare us into backing down? You know, a show of force?” She asked, looking at her brother.
“I mean, I sure hope so. They might also try and beat you up, but I’m guessing that isn't gonna end without bloodshed,” he replied, looking at the assortment of weapons they all carried.
“Right, so we keep on going about our business during the day. Making damn sure we aren't followed anymore. Then we make sure to be back here early every day, with a knife under our pillow. Is that the plan?” Sapphire asked.
“Well we can’t just stay here, we have way too much to do. Another day with Tink and he will hopefully be able to keep himself busy without killing himself."
“Saph, you are gonna need to tell me what the fuck it is you are doing at that place some time,” Haiko went, giving Sapphire a friendly nudge to the shoulder.
“I might just keep that a surprise for you,” she replied, hitting back a little harder.
“Oh, by the way, what was the price on the window?” Dakota asked as Haiko got up to go actually do his job for a bit.
“Uhh. Don’t know actually, you want a receipt for it?”
“Yes please, I’m gonna pay for that,” Dakota responded, to Sapphire’s surprise. She didn’t think they had to, nor were windows cheap. The strained expression Dakota got when she received the bill would seem to back that assumption up, even if she didn’t let them know what the price had been.
Following yesterday's round of catch the goose, they hadn’t actually managed to find most of the things they needed. so they had swung by to pick up Junior to show the way, leaving the by now common sight of a sleep-deprived Tink to carry on working.
Following some directions from a smith Junior knew, they had finally found a place that seemed to be a proper mithril smith. It wasn’t a large place nor could you even see the forge, as it was hidden away inside the massive squat building behind the shopfront. Everything was very nice though, gleaming weapons and armor on display for all to see. Even if only a few of the things were actually mithril.
Sapphire's eyes damn near watered at the sight of the prices. Even a hunting knife made out of the stuff commanded an exorbitant sum, so she guessed most things here were probably made to order. Nevertheless, it was on the list, so when they had the money they would be doing some exceedingly expensive shopping.
They had been keeping an eye out for Trewor or anyone else trying to tail them. They agreed chances were good Trewor had just run away after what happened yesterday. In that case, the Flaxens would of course likely just hire someone else.
“Hey that sounds familiar,” Sapphire let out as they passed a small potion shop. “Hold up, we need to go say ‘Hi.’ ”
“Oh yeah, definitely” Dakota responded as they turned to walk into the small potion shop.
“Quinlin’s Potions and Care, how can I he... Oh Dakota! It’s good to see you! Oh and hello Saph, and even Baleboy, it was about time they dragged you in here. Is Essy with you?”
“Sadly not this time,” Dakota replied with a smile. ”Good to see you, Ignis.”
“Oh well, she can’t hog all the travel expenses after all. How’s she doing?” Dakota’s smile did falter a bit at that. Sapphire also grew a more sombre expression despite her best efforts.
“She's getting better, though she has been quite sick,” Dakota replied, looking around the small shop. Content that it was empty she carried on. “She got stabbed with a poisoned blade. We are here to lay a case against the Lady who did it.”
“We call her the bitch,” Balethon added in, as the warm friendly expression of Esmeralda’s sister faded.
“What poison?” She asked tentatively.
“Green dragon,” Dakota replied plainly. “You can thank Colonel Hashaw and Baron that she is still with us. She is getting better by the day though, so don’t you worry.”
“Gods in heaven,” Ignis replied, sitting down on a stool she had behind the counter.
“Don’t worry, we got her in chains and Essy is doing fine,” Dakota reiterated.
”Sounds like you have had an exciting time,” Ignis replied, looking up.
“More than you know,” Sapphire added. Ignis let out a breath before looking up, the smile returning to her face.
“Well, it’s good to hear we didn’t lose her this time either. I see you brought some new faces. Is the Royal Guard for show, or did Sapphire get what she always wanted?” Ignis questioned, looking to Dakota, who did a double-take before she broke out laughing.
“Not funny,” Sapphire stated, looking away. ‘Goddammit, why do her and Essy have to be alike.’
“I’m sorry what?” Maiko questioned, clearly confused.
“Did no one tell you Sapphire used to want to become a Royal Guard? I’m guessing you’re the next best thing,” Ignis continued, also laughing now.
“Uhm… no… wait, what?.” Maiko responded, sounding very confused as he looked at Sapphire.
‘You have got to be shitting me,’ Sapphire cursed to herself. “No, Ignis, I did not score a Royal Guard nor am I trying to! Come on, you know I don’t like that story,” Sapphire interjected, stretching out her arm as if she was going to grab Ignis. ‘Best kind of defense is a good offense,’ Sapphire thought to herself as she turned to look at Balethon, handily avoiding Maiko’s confused gaze. “Balethon scored a trader escort though. Well, more like she found a new boy toy I think.”
“Ha, I can believe that,” Ignis responded, turning her attention to the very miffed-looking Balethon.
“She likes me okay!” He predictably protested. “You're just jealous I’m not giving you the attention you want,” he then replied, pointing at Sapphire.
“Oh come on, we all know that one is a lie,” Dakota weighed in. Junior just stood looking around, utterly bewildered at what was going on.
“Oh, how I missed this. I’ll put the kettle on if anyone wants some tea. Have a browse in the meantime.”
They had all answered in the affirmative as they went about having a look at the selection. Potions were expensive, though it was cheaper in the city than if you had to buy from someone like Vulzan. Still, Sapphire could hardly afford anything in here aside from some medicinal stuff for various ailments.
They had a pleasant talk, conveniently leaving out the fact they might be walking around with a target on their back. It had been over half a year since Ignis had last heard of what was happening at the keep, so there had been a fair bit to talk about. Of course, Tom inevitably came up; Ignis had been more interested to hear about how he dealt with the kids though. All in all, it had mostly been pleasant small talk, which was a nice change from people asking about the battles or Tom. With cups empty and a promise to pop by again later for another chat and possibly buying something for once, they had continued their search for stuff they needed.
__________________________________________________________________________________
So then Jacky got to learn about Nascar and see a jetfighter in action, sort of at least. Hopefully, she and Jarix won't get minority complexes. Sapphire had a fairly nice day for once without being either followed, threatened, or stressed to the point of cracking.
But what did you think? If you enjoyed do let me know down below. Alternatively have a go at shouting at me for the lack of action in this one, or whatever else I might have fucked up with.
Until next time have an awesome day
ko-fi For having a pretty picture commissioned.
Sapphire
Wiki Discord
First Previous Next

Yes, as you read, cross post from boringpeople, but it's well worth a read, as long as it is. All credit to u/jn_ku, and go read the other parts. Godspeed autists
​
Disclaimer: I am not a financial advisor. This entire post represents my personal views and opinions, and should not be taken as financial advice (or advice of any kind whatsoever). I encourage you to do your own research, take anything I write with a grain of salt, and hold me accountable for any mistakes you may catch. Also, full disclosure, I hold a net long position in GME, but my cost basis is very low (average ~$67--I have to admit, the drop today was too tasty so my cost basis went up from yesterday)/share with my later buys averaged in), and I'm using money I can absolutely lose. My capital at risk and tolerance for risk generally is likely substantially different than yours. In this post I will go a little further and speculate more than I'd normally do in a post due to the questions I've been getting, so fair warning, some of it might be very wrong. I suspect we'll learn some of the truth years from now when some investigative journalist writes a book about it.
Thank you everyone for the comments and questions on the first and second post on this topic.
Today was a study in the power of fear, courage, and the levers you can pull when you wield billions of dollars...
Woops, excuse me. I'm sorry hedge fund guys... I meant trillions of dollars--I just briefly forget you control not just your own but a lot of other peoples' money too for a moment there.
Also, for people still trading this on market-based rationale (as I am), it was a good day to measure the conviction behind your thesis. I like to think I have conviction, but in case you are somehow not yet familiar with the legend of DFV, you need to see these posts (fair warning, nsfw, and some may be offended/triggered by the crude language). The last two posts might be impressive, but you should follow it in chronological order and pay attention to the evolution of sentiment in the comments to experience true enlightenment.
Anyway, I apologize, but this post will be very long--there's just a lot to unpack.
Pre-Market
Disclaimer: given yesterday's pre-market action I didn't even pay attention to the screen until near retail pre-market. I'm less confident in my ability to read what's going on in a historical chart vs the feel I get watching live, but I'll try.
Early in the pre-market it looks to me like some momentum traders are taking profit, discounting the probability that the short-side will give them a deep discount later, which you can reasonably assume given the strategy they ran yesterday. If they're right they can sell some small volume into the pre-market top, wait for the hedge funds try to run the price back down, and then lever up the gains even higher buying the dip. Buy-side here look to me like people FOMOing and YOLOing in at any price to grab their slice of gainz, or what looks to be market history in the making. No way are short-side hedge funds trying to cover anything at these prices.
Mark Cuban--well said! Free markets baby!
Mohamed El-Erian is money in the bank as always. "upgrade in quality" on the pandemic drop was the best, clearest actionable call while most were at peak panic, and boy did it print. Your identifying the bubble as the excessive short (vs blaming retail activity) is money yet again. Also, The PAIN TRADE (sorry, later interview segment I only have on DVR, couldn't find on youtube--maybe someone else can)!
The short attack starts, but I'm hoping no one was panicking this time--we've seen it before. Looks like the momentum guys are minting money buying the double dip into market open.
CNBC, please get a good market technician to explain the market action. Buy-side dominance, sell-side share availability evaporating into nothing (look at day-by-day volume last few days), this thing is now at runaway supercritical mass. There is no changing the trajectory unless you can change the very fabric of the market and the rules behind it (woops, I guess I should have knocked on wood there).
If you know the mechanics, what's happening in the market with GME is not mysterious AT ALL. I feel like you guys are trying to scare retail out early "for their own good" (with all sincerity, to your credit) rather than explain what's happening. Possibly you also fear that explaining it would equate to enabling/encouraging people to keep trying to do it inappropriately (possibly fair point, but at least come out and say that if that's the case). Outside the market, however...wow.
You Thought Yesterday Was Fear? THIS is Fear!
Ok short-side people, my hat is off to you. Just when I thought shouting fire in a locked theater was fear mongering poetry in motion, you went and took it to 11. What's even better? Yelling fire in a theater with only one exit. That way people can cause the financial equivalent of stampede casualties. Absolutely brilliant.
Robin Hood disables buying of GME, AMC, and a few of the other WSB favorites. Other brokerages do the same. Even for people on 0% margin. Man, and here I thought I had seen it all yesterday.
Side note: I will give a shout out to TD Ameritrade. You guys got erroneously lumped together with RH during an early CNBC segment, but you telegraphed the volatility risk management changes and gradually ramped up margin requirements over the past week. No one on your platform should have been surprised if they were paying attention. And you didn't stop anyone from trading their own money at any point in time. My account balance thanks you. I heard others may have had problems, but I'll give you the benefit of the doubt given the DDOS attacks that were flyiing around
Robin Hood. Seriously WTF. I'm sure it was TOTALLY coincidence that your big announcements happen almost precisely when what has to be one of the best and most aggressive short ladder attacks of all time starts painting the tape, what looked like a DDOS attack on Reddit's CDN infrastructure (pretty certain it was the CDN because other stuff got taken out at the same time too), and a flood of bots hit social media (ok, short-side, this last one is getting old).
Taking out a large-scale cloud CDN is real big boy stuff though, so I wouldn't entirely rule out nation state type action--those guys are good at sniffing out opportunities to foment social unrest.
Anyway, at this point, as the market dives, I have to admit I was worried for a moment. Not that somehow the short-side would win (hah! the long-side whales in the pond know what's up), but that a lot of retail would get hurt in the action. That concern subsided quite a bit on the third halt on that slide. But first...
A side lesson on market orders
Someone printed bonus bank big time (and someone lost--I feel your pain, whoever you are).
During the face-ripping volatility my play money account briefly ascended to rarified heights of 7 figures. It took me a second to realize it, then another second to process it. Then, as soon as it clicked, that one, glorious moment in time was gone.
What happened?
During the insane chop of the short ladder attack, someone decided to sweep the 29 Jan 21 115 Call contracts, but they couldn't get a grip on the price, which was going coast to coast as IV blew up and the price was being slammed around. So whoever was trying to buy said "F it, MARKET ORDER" (i.e. buy up to $X,XXX,XXX worth of contracts at any price). This is referred to as a sweep if funded to buy all/most of the contracts on offer (HFT shops snipe every contract at each specific price with a shotgun of limit orders, which is far safer, but something only near-market compute resources can do really well). For retail, or old-tech pros, if you want all the contracts quickly, you drop a market order loaded with big bucks and see what you get... BUT, some clever shark had contracts available for the reasonable sum of... $4,400, or something around that. I was too stunned to grab a screencap. The buy market order swept the book clean and ran right into that glorious, nigh-obscene backstop limit. So someone got nearly $440,000 PER CONTRACT that was, at the time theoretically priced at around $15,000. $425,000 loss... PER CONTRACT. Maybe I'm not giving the buyer enough credit.. you can get sniped like that even if you try to do a safety check of the order book first, but, especially in low liquidity environments, if a HFT can peak into your order flow (or maybe just observes a high volume of sweeps occurring), they can end up front running your sweep, pick off the reasonable contracts, and slam a ridiculous limit sell order into place before your order makes it to the exchange. Either way, I hope that sweep wasn't loaded for bear into the millions. If so... OUCH. Someone got cleaned out.
So, the lesson here folks... in a super high volatility, low-liquidity market, a market order will just run up the ladder into the first sell order it can find, and some very brutal people will put limit sells like that out there just in case they hit the jackpot. And someone did. If you're on the winning side, great. It can basically bankrupt you if you're on the losing side. My recommendation: Just don't try it. I wouldn't be surprised if really shady shenanigans were involved in this, but no way to know (normally that's crazy-type talk, but after today....peeking at order flow and sniping sweeps is one of the fastest, most financially devastating ways to bleed big long-side players, just sayin').
Back to the market action..
A Ray of Light Through the Darkness
So I was worried watching the crazy downward movement for two different reasons.
On the one hand, I was worried the momentum pros would get the best discounts on the dip (I'll admit, I FOMO'd in too early, unnecessarily raising my cost basis).
On the other hand, I was worried for the retail people on Robin Hood who might be bailing out into incredibly steep losses because they had only two options: Watch the slide, or bail. All while dealing with what looked to me like a broad-based cloud CDN outage as they tried to get info from WSB HQ, and wondering if the insta-flood of bot messages were actually real people this time, and that everyone else was bailing on them to leave them holding the bag.
But I saw the retail flag flying high on the 3rd market halt (IIRC), and I knew most would be ok. What did I see, you ask? Why, the glorious $211.00 / $5,000 bid/ask spread. WSB Reddit is down? Those crazy mofos give you the finger right on the ticker tape. I've been asked many times in the last few hours about why I was so sure shorts weren't covering on the down move. THIS is how I knew. For sure. It's in the market data itself.
I'll admit, I tried to one-up those bros with a 4206.90 limit sell order, but it never made it through. I'm impressed that the HFT guys at the hedge fund must have realized really quickly what a morale booster that kind of thing would have been, and kept a lower backstop ask in place almost continuously from then on I'm sure others tried the same thing. Occasionally $1,000 and other high-dollar asks would peak through from time to time from then on, which told me the long-side HFTs were probably successfully sniping the backstops regularly.
So, translating for those of you who found that confusing. First, such a high ask is basically a FU to the short-side (who, as you remember, need to eventually buy shares to cover their short positions). More importantly, as an indicator of retail sentiment, it meant that NO ONE ELSE WAS TRYING TO SELL AT ANY PRICE LOWER THAN $5,000. Absolutely no one was bailing out.
I laughed for a minute, then started getting a little worried. Holy cow.. NO retail selling into the fear? How are they resisting that kind of price move??
The answer, as we all know now... they weren't afraid... they weren't even worried. They were F*CKING PISSED.
Meanwhile the momentum guys and long-side HFTs keep gobbling up the generously donated shares that the short-side are plowing into their ladder attack. Lots of HFT duels going on as long-side HFTs try to intercept shares meant to travel between short-side HFT accounts for their ladder. You can tell when you see prices like $227.0001 constantly flying across the tape. Retail can't even attempt to enter an order like that--those are for the big boys with privileged low-latency access.
The fact that you can even see that on the tape with human eyes is really bad for the short-side people.
Why, you ask? Because it means liquidity is drying up, and fast.
The Liquidity Tide is Flowing Out Quickly. Who's Naked (short)?
Market technicals time. I still wish this sub would allow pictures so I could throw up a chart, but I guess a table will do fine.
DateVolumePrice at US Market CloseFriday, 1/22/21197,157,196$65.01Monday, 1/25/21177,874,00$76.79Tuesday, 1/26/21178,587,974$147.98Wednesday, 1/27/2193,396,666$347.51Thursday, 1/28/2158,815,805$193.60
What do I see? I see the shares available to trade dropping so fast that all the near-exchange compute power in the world won't let the short-side HFTs maintain order flow volume for their attacks. Many retail people asking me questions thought today was the heaviest trading. Nope--it was just the craziest.
What about the price dropping on Thursday? Is that a sign that the short-side pulled a miracle out and pushed price down against a parabolic move on even less volume than Wednesday? Is the long side running out of capital?
Nope. It means the short-side hedge funds are just about finished.
But wait, I thought the price needed to be higher for them to be taken out? How is it that price being lower is bad for them? Won't that allow them to cover at a lower price?
No, the volume is so low that they can't cover any meaningful fraction of their position without spiking the price parabolic almost instantly. Just not enough shares on offer at reasonable prices (especially when WSB keeps flashing you 6942.00s).
It's true, a higher price hurts, but the interest charge for one more day is just noise at this point. The only tick that will REALLY count is the last tick of trading on Friday.
In the meantime, the price drop (and watching the sparring in real time) tells me that the long-side whales and their HFT quants are so certain of the squeeze that they're no longer worried AT ALL about whether it will happen, and they aren't even worried at all about retail morale to help carry the water anymore.
Instead, they're now really, really worried about how CHEAPLY they can make it happen.
They are wondering if they can't edge out just a sliver more alpha out of what will already be a blow-out trade for the history books (probably). You see, to make it happen they just have to keep hoovering up shares. It doesn't matter what those shares cost. If you're certain that the squeeze is now locked in, why push the price up and pay more than you have to? Just keep pressing hard enough to force short-side to keep sending those tasty shares your way, but not so much you move the price. Short-side realizes this and doesn't try to drive price down too aggressively. They can't afford to let price run away, so they have to keep some pressure on at the lowest volume they can manage, but they don't want to push down too hard and give the long-side HFTs too deep of a discount and bleed their ammo out even faster. That dynamic keeps price within a narrow (for GME today, anyway) trading range for the rest of the day into the close.
Good plan guys, but those after market people are pushing the price up again. Damnit WSB bros and Euros, you're costing those poor long-side whales their extra 0.0000001% of alpha on this trade just so you can run up your green rockets... See, that's the kind of nonsense that just validates Lee Cooperman's concerns.
On a totally unrelated note, I have to say that I appreciate the shift in CNBC's reporting. Much more thoughtful and informed. Just please get a good market technician in there who will be willing to talk about what is going on under the hood if possible. A lot of people watching on the sidelines are far more terrified than they need to be because it all looks random to them. And they're worried that you guys look confused and worried--and if the experts on the news are worried....??!
You should be able to find one who has access to the really good data that we retailers can only guess at, who can explain it to us unwashed masses.
Ok, So.. Questions
There is no market justification for this. How can you tell me is this fundamentally sound and not just straight throwing money away irresponsibly?? (side note: not that that should matter--if you want to throw your money away why shouldn't you be allowed to?)
We're not trading in your securities pricing model. This isn't irrational just because your model says long and short positions are the same thing. The model is not a real market. There is asymmetrical counterparty risk here given the shorts are on the hook for all the money they have, and possibly all the money their brokers have, and possibly anyone with exposure to the broker too! You may want people to trade by the rules you want them to follow. But the rest of us trade in the real market as it is actually implemented. Remember? That's what you tell the retailers who take their accounts to zero. Remember what you told the KBIO short-squeezed people? They had fair warning that short positions carry infinite risk, including more than your initial investment. You guys know this. It's literally part of your job to know this.
But-but-the systemic risk!! This is Madness!
...Madness?
THIS. IS. THE MARKET!!! *Retail kicks the short-side hedge funds down an infinity loss black hole\*.
Ok, seriously though, that is actually a fundamentally sound, and properly profit-driven answer at least as justifiable as the hedge funds' justification for going >100% of float short. If they can be allowed to gamble INFINITE LOSSES because they expect to make profit on the possibility the company goes bankrupt, can't others do the inverse on the possibility the company I don't know.. doesn't go bankrupt and gets a better strategy from the team that created what is now a $43bn market cap company (CHWY) that does exactly some of the things GME needs to do (digital revenue growth) maybe? I mean, I first bought in on that fundamental value thesis in the 30s and then upped my cost basis given the asymmetry of risk in the technical analysis as an obvious no-brainer momentum trade. The squeeze is just, as WSB people might say, tendies raining down from on high as an added bonus.
I get that you disagree on the fundamental viability of GME. Great. Isn't that what makes a market?
Regarding the consequences of a squeeze, in practice my expectation was maybe at worst some kind of ex-market settlement after liquidation of the funds with exposure to keep things nice and orderly for the rest of the market. I mean, they handled the VW thing somehow right? I see now that I just underestimated elite hedge fund managers though--those guys are so hardcore (I'll explain why I think so a bit lower down).
If hedge fund people are so hardcore, how did the retail long side ever have a chance of winning this squeeze trade they're talking about?
Because it's an asymmetrical battle once you have short interest cornered. And the risk is also crazily asymmetrical in favor of the long side if short interest is what it is in GME. In fact, the hedge funds essentially cornered themselves without anyone even doing anything. They just dug themselves right in there. Kind of impressive really, in a weird way.
What does the short side need to cover? They need the price to be low, and they need to buy shares.
How does price move lower? You have to push share volume such that supply overwhelms demand and price therefore goes down (man, I knew econ 101 would come in handy someday).
But wait... if you have to sell shares to push the price down.. won't you just undo all your work when you have to buy it back to actually cover?
The trick is you have to push price down so hard, so fast, so unpredictably, that you SCARE OTHER PEOPLE into selling their shares too, because they're scared of taking losses. Their sales help push the price down for free! and then you scoop them up at discount price! Also, there are ways to make people scared other than price movement and fear of losses, when you get right down to it. So, you know, you just need to get really, really, really good at making people scared. Remember to add a line item to your budget to make sure you can really do it right.
On the other hand..
What does the long side need to do? They need to own as much of the shares as they can get their hands on. And then they need to hold on to them. They can't be weak hands either. They need to be hands that will hold even under the most intense heat of battle, and the immense pressure of mind-numbing fear... they need to be as if they were made of... diamond... (oh wow, maybe those WSB people kind of have a point here).
Why does this matter? Because at some point the sell side will eventually run out of shares to borrow. They simply won't be there, because they'll be safely tucked away in the long-side's accounts. Once you run out of shares to borrow and sell, you have no way to move the price anymore. You can't just drop a fat stack--excuse me, I mean suitcase (we're talking hedge fund money here after all)--of Benjamins on the ticker tape directly. Only shares. No more shares, no way to have any direct effect on the price whatsoever.
Ok, doesn't that just mean trading stops? Can't you just out-wait the long side then?
Well, you could.. until someone on the long side puts 1 share up on a 69420 ask, and an even crazier person actually buys at that price on the last tick on a Friday. Let's just say it gets really bad at that point.
Ok.. but how do the retail people actually get paid?
Well, to be quite honest, it's entirely up to each of them individually. You've seen the volumes being thrown around the past week+. I guarantee you every single retailer out there could have printed money multiple times trading that flow. If they choose to, and time it well. Or they could lose it all--this is the market. Some of them apparently seem to have some plan, or an implicit trust in certain individuals to help them know when to punch out. Maybe it works out, but maybe not. There will be financial casualties on the field for sure--this is the bare-knuckled capitalist jungle after all, remember? But everyone ponied up to the table with their own money somehow, so they all get to play in the big leagues just like everyone else. In theory, anyway.
And now, Probably the #1 question I've been asked on all of these posts has been: So what happens next? Do we get the infinity squeeze? Do the hedge funds go down?
Great questions. I don't know. No one does. That's what I've said every time, but I get that's a frustrating answer, so I'll write a bit more and speculate further. Please again understand these are my opinions with a degree of speculation I wouldn't normally put in a post.
The Market and the Economy. Main Street, Wall Street, and Washington
The pandemic has hurt so many people that it's hard to comprehend. Honestly, I don't even pretend to be able to. I have been crazy fortunate enough to almost not be affected at all. Honestly, it is a little unnerving to me how great the disconnect is between people who are doing fine (or better than fine, looking at my IRA) versus the people who are on the opposite side of the ever-widening divide that, let's be honest, has been growing wider since long before the pandemic.
People on the other side--who have been told they cannot work even if they want to, who wonder if congress will get it together to at least keep them from getting thrown out of their house if they have to keep taking one for the team for the good of all, are wondering if they're even living in the same reality.
Because all they see on the news each day is that the stock market is at record highs, or some amazing tech stocks have 10x'd in the last 6 months. How can that be happening during a pandemic? Because The Market is not The Economy. The Market looks forward to that brighter future that Economy types just need to wait for. Don't worry--it'll be here sometime before the end of the year. We think. We're making money on that assumption right now, anyway. Oh, by the way, if you're in The Market, you get to get richer as a minor, unearned side-effect of the solutions our governments have come up with to fight the pandemic.
Wow. That sounds amazing. How do I get to part of that world?
Retail fintech, baby. Physical assets like real estate might be a bit out of reach at the moment, but stocks will do. I can even buy fractional shares of BRK/A LOL.
Finally, I can trade for my own slice of heaven, watching that balance go up (and up--go stonks!!). Now I too get to dream the dream. I get to feel connected to that mythical world, The Market, rather than being stuck in the plain old Economy. Sure, I might blow up my account, but that's because it's the jungle. Bare-knuckled, big league capitalism going on right here, and at least I get to show up an put my shares on the table with everyone else. At least I'm playing the same game. Everyone has to start somewhere--at least now I get to start, even if I have to learn my lesson by zeroing my account a few times. I've basically had to deal with what felt like my life zeroing out a few times before. This is number on a screen going to 0 is nothing.
Laugh or cry, right? I'll post my losses on WSB and at least get some laughs.
Geez, some of the people here are making bank. I better learn from them and see if they'll let me in on their trades. Wow... this actually might work. I don't understand yet, but I trust these guys telling me to hold onto this crazy trade. I don't understand it, but all the memes say it's going to be big.
...WOW... I can pay off my credit card with this number. Do I punch out now? No? Hold?... Ok, getting nervous watching the number go down but I trust you freaks. We're still in the jungle, but at least I'm in with with my posse now. Market open tomorrow--we ride the rocket baby! And if it goes down, at least I'm going down with my crew. At least if that happens the memes will be so hilarious I'll forget to cry.
Wow.. I can't believe it... we might actually pull this off. Laugh at us now, "pros"!
We're in The Market now, and Market rules tell us what is going to happen. We're getting all that hedge fund money Right? Right?
Maybe.
First, I say maybe because nothing is ever guaranteed until it clears. Secondly, because the rules of The Market are not as perfectly enforced as we would like to assume. We are also finding out they may not be perfectly fair. The Market most experts are willing to talk about is really more like the ideal The Market is supposed to be. This is the version of the market I make my trading decisions in. However, the Real Market gets strange and unpredictable at the edges, when things are taken to extremes, or rules are pushed beyond the breaking point, or some of the mechanics deep in the guts of the Real Market get stretched. GME ticks basically all of those boxes, which is why so many people are getting nervous (aside from the crazy money they might lose). It's also important to remember that the sheer amount of money flowing through the market has distorting power unto itself. Because it's money, and people really, really, really like their money--especially when they're used to having a lot of it, and rules involving that kind of money tend to look more... flexible, shall we say.
Ok, back to GME. If this situation with GME is allowed to play out to its conclusion in The Market, we'll see what happens. I think all the long-side people get the chance to be paid (what, I'm not sure--and remember, you have to actually sell your position at some point or it's all still just numbers on your screen), but no one knows for certain.
But this might legitimately get so big that it spills out of The Market and back into The Economy.
Geez, and here I thought the point of all of this was so that we all get to make so much money we wouldn't ever have to think and worry about that thing again.
Unfortunately, while he's kind of a buzzkill, Thomas Petterfy has a point. This could be a serious problem.
It might blow out The Market, which will definitely crap on The Economy, which as we all know from hard experience, will seriously crush Main Street.
If it's that big a deal, we may even need Washington to be involved. Once that happens, who knows what to expect.. this kind of scenario being possible is why I've been saying I have no idea how this ends, and no one else does either.
How did we end up in this ridiculous situation? From GAMESTOP?? And it's not Retail's fault the situation is what it is.. why is everyone telling US that we need to back down to save The Market?? What about the short-side hedge funds that slammed that risk into the system to begin with?? We're just playing by the rules of The Market!!
Well, here are my thoughts, opinions, and some even further speculation... This may be total fantasy land stuff here, but since I keep getting asked I'll share anyway. Just keep that disclaimer in mind.
A Study in Big Finance Power Moves: If you owe the bank $10,000, it's your problem...
What happens when you owe money you have no way to pay back? It's a scary question to have to face personally. Still, on balance and on average, if you're fortunate enough to have access to credit the borrowing is a risk that is worth taking (especially if you're reasonably careful). Lenders can take a risk loaning you money, you take a risk by borrowing in order to do something now that you would otherwise have had to wait a long time or maybe would never have realistically been able to do otherwise. Sometimes it doesn't work out. Sometimes it's due to reasons totally beyond your control. In any case, if you find yourself there you have no choice but to dust yourself off, pick yourself up as best as you can, and try to move on and rebuild. A lot of people had to learn that in 2008. Man that year really sucked.
Wall street learned their lessons too. Most learned what I think most of us would consider the right lessons--lessons about risk management, and the need to guard vigilantly against systemic risk, concentration of risk through excess concentration of leverage on common assets, etc. Many suspect that at least a few others may have learned an entirely different set of, shall we say, unhealthy lessons. Also, to try to be completely fair, maybe managing other peoples' money on 10x+ leverage comes with a kind of pressure that just clouds your judgement. I could actually, genuinely buy that. I know I make mistakes under pressure even when I'm trading risk capital I could totally lose with no real consequence. Whatever the motive, here's my read on what's happening:
First, remember that as much fun as WSB are making of the short-side hedge fund guys right now, those guys are smart. Scary smart. Keep that in mind.
Next, let's put ourselves in their shoes.
If you're a high-alpha hedge fund manager slinging trades on a $20bn 10x leveraged to 200bn portfolio, get caught in a bad situation, and are down mark-to-market several hundred million.. what do you do? Do you take your losses and try again next time? Hell no.
You're elite. You don't realize losses--you double down--you can still save this trade no sweat.
But what if that doesn't work out so well and you're in the hole >$2bn? Obvious double down. Need you ask? I'm net up on the rest of my positions (of course), and the momentum when this thing makes its mean reversion move will be so hot you can almost taste the alpha from here. Speaking of momentum, imagine the move if your friends on TV start hyping the story harder! Genius!
Ok, so that still didn't work... this is now a frigging 7 sigma departure from your modeled risk, and you're now locked into a situation that is about as close to mathematically impossible to escape as you can get in the real world, and quickly converging on infinite downside. Holy crap. The fund might be liquidated by your prime broker by tomorrow morning--and man, even the broker is freaking out. F'in Elon Musk and his twitter! You're cancelling your advance booking on his rocket ship to Mars first thing tomorrow... Ok, focus--this might legit impact your total annual return. You need a plan, and you know the smartest people on the planet, right? The masters of the universe! Awesome--they've even seen this kind of thing before and still have the playbook!! Of course! It's obvious now--you borrow a few more billion and double down again first thing in the morning. So simple. Sticky note that Mars trip cancellation so you don't forget.
Ok... so that didn't work? You even cashed in some pretty heavy chits too. Ah well, that was a long shot anyway. So where were you? Oh yeah.. if shenanigans don't work, skip to page 10...
...Which says, of course, to double down again. Anyone even keeping track anymore? Oh, S3 says it's $40bn and we're going parabolic? Man, that chart gives me goosebumps. All according to plan...
So what happens tomorrow? One possible outcome of PURE FANTASTIC SPECULATION...
End of the week--phew. Never though it'd come. Where are you at now?... Over $9000*!!! Wow. You did it boys, and as a bonus the memes will be so sweet.
*side note: add 8 zeros to the end...
Awesome--your problems have been solved. Because...
..
BOOM
Now it's EVERYONE's problem. Come at me, Chamath, THIS is REAL baller shit.
Now all you gotta do is make all the hysterical retirees watching their IRAs hanging in the balance blame those WSB kids. Hahaha. Boomers, amirite? hate when those kids step on their law--I mean IRAs. GG guys, keep you memes. THAT is how it's done.
Ok, but seriously, I hope that's not how it ends. I guess we just take it day by day at this point.
Apologies for the length. Good luck in the market!
Also, apologies in advance for formatting, spelling, and grammatical errors. I was typing this thing in between doing all kinds of other things for most of the day.

So another round one, chapter 90. Only 10 to go for the big number, this actually also marks 1000 novel size pages of story-making just over 277.000 words thus far O_o For comparison, the lord of the rings is 576.000 so damn near halfway there... Holy fuck that is a lot of writing in just over three months. To mark the occasion this one is a special one. at some point, during today's story, there is going to be a fade to black and a little link (If you are speed machines please have patients it's coming ASAP)
Now in there, you will find nothing but gratuitous pancake, this is so that you have the choice, you may skip the standalone chapter and I promise you are not missing any of the actual story, at least as little as I could manage. for the rest of you Enjoy,
With the semantics out of the way, I say we get on with the story,
ko-fi For having more pretty pictures commissioned.
Sapphire
Wiki Discord
First Previous Next
__________________________________________________________________________________
Chapter 90: A Bad Night
Luke had returned with a gaggle of kids, who all looked rather overwhelmed by what they saw coming out. There were a lot of them, Tom counted twelve in total. All of them rather young; he guessed the oldest one looked about nine.
“Look, dragon!” a young boy shouted, running over to Jarix with a few others on his heels. Some were looking around, clearly searching for people who might not be here anymore. Others stood staring at Tom.
The sight of other kids also caused a fair amount of excitement, Luke ushering the more timid kids towards the ones from Hylsdal.
Tom just stood there putting a hand around Jacky’s waist, looking at the best reason for doing all this. He chuckled as Jarix elevated his head just out of grabbing range as the more excitable of the kids tried to touch his face. He had a smile on though, even if he looked a little unsure of what to do. Zarko was on hand to help though, telling off the kids who tried to climb up the wounded dragon.
It took some coaxing, but in the end, most of the kids had been convinced to start playing with each other, though some were still around sitting either crying or just keeping to themselves. Lothal was doing his best to try and console his friends and doing a remarkably good job of it. Tom couldn't decide if he was proud or sad at seeing an eleven-year-old acting like an adult.
Dinner was nothing special, just some more of the stew from earlier with some rather stale tasting bread. Jacky, Tom, Zarko, and Unkai had sat together with the lady, Luke, Requi and the healer who was sort of conscious for the moment. She was apparently called Quin, at least for short. Unkai too was sitting rather slack-eared, clearly having been put to hard work already.
Jarix was given some cuts of cured meat. The lady had brought out both some decent ale and even some wine, which was passed around the table. Tom had never tried dragonette wine before, so, despite his reservations about mixing alcohol with blood loss, he poured a cup for himself. That was an old student tactic, after all, to donate blood before a night on the town. It made things a bit cheaper.
“We might not be able to put together a feast, but we can do this, a small token of thanks. Luke, if you wouldn’t mind,” The Lady went as she took her seat, Luke standing up raising a glass.
“To the heroes in our hour of need!”
Tom damn near stood up to join Luke, Zarko grabbing him by the shoulder to keep him seated. As the assembled dragonettes of the keep gave a toast. Tom didn’t really know if he felt proud or just uncomfortable at this point. On one hand, he could look around the room to see many faces, most of which appeared happy. On the other hand, many definitely weren’t: a lone wounded father with a sobbing kid; the kids from Hylsdal; the countless wounded, some looking like they might not fly or even walk properly again.
“To the crazy bastard who made it possible,” Jackalope went as she raised her cup looking at Tom, apparently figuring out what was being toasted.
“Hey!” Jarix let out, clearly trying to sound offended. “To the crazy bastards who made it possible,” Zarko corrected, raising her cup.
“To wiping those fuckers off the map,” Tom joined in, feeling a little left out.
“Cheers to that,” The silvered huntress replied without much enthusiasm, slamming her drink down in one go. She was joined by the others. Tom took his time with his wine though. As expected it was rather sweet, definitely not bad though. They hadn’t made a huge thing out of the meal, it was just stew and bread after all, even if their drinks were well above average.
It had been a rather awkward meal though. Jackalope couldn’t partake in the conversation unless Tom or someone else wrote down for her what was going on. They all did their best to avoid the more depressing subject matters, but it was pretty damn hard to avoid them in their current state. Quite a few of the others had taken to drinking rather heavily. Tom could hardly blame them, but he kept it mild for now. Jacky, though, did make a dent in the ale supply. She didn’t get piss drunk, but she was definitely inebriated by now.
“You know, I’ve never been called a hero before,” Jacky went, leaning on Tom after they had finished the meal. “You still got the ace though… You always get the ace… Why are you so damn good at killing?” She questioned hanging on his shoulders.
Tom didn’t really know how to answer her on that one. “You know what,” She went, pulling back and poking him in the chest with a finger. “You get to teach me how. You’re not getting the ace next time,” Tom pondered for a second if that was a smart thing to agree to. It was likely going to happen though, so why not.
“I guess that’s the smart part about being deaf, I can’t hear if you're protesting, so I’m just gonna say you agreed,” Jackalope continued before he managed to nod his reply. She poured a fresh mug for the both of them, snickering. Tom debated getting out the notepad to try and tell her he needed to be a little careful when it came to alcohol right now. She beat him to it though. “You’re not drinking like last time; afraid we might do something stupid?”
Unkai damn near choked at that one. Zarko just shook her head, looking a tad embarrassed. ’Remember the angry smith Tom, Remember the angry smith,’ he repeated to himself. He got out the notepad to write down a response. Tom made well sure no one else saw what he wrote as he showed it to Jacky.
“I’m wounded, also your mother,” she pulled back a bit, looking a little annoyed.
“She is not here nor will she be... Hey Unkai! Can you give him a check? He claims to be wounded; I don’t want him dying on me.” She went, sounding entirely inappropriate.
Even Zarko had to suppress a slight laugh at that, Unkai looking like a deer in the headlights as Jacky’s attention switched to him.
“I mean sure. I’ll just finish this,” the healer replied, gesturing at his cup.
“I can’t hear you,” Jackalope reiterated with a side to side head bob. Unkai looked very embarrassed, just giving her a thumbs up instead.
‘Oh boy,’ Tom thought to himself, shrinking down.
“I think he needs more liquid courage to handle me though. Watch closely Unkai, you might learn how to grow a spine. Even if it’s only for a bit,” Jackalope continued, laughing at her own joke as she poured another drink for herself and refilling Tom’s cup.
“The man who went toe to toe with a small army and he needs help to handle you. What does that tell you?” Zarko let out, looking at Tom, seeming very pleased with herself.
“Don’t let them get to you Tom, you're braver than her,” Jarix added, ensuring that everyone in the entire hall was now invested in the conversation.
Tom just picked up the mug of ale she had poured for him. Jackalope excitedly raised hers as they knocked them together. ‘May the hangover have mercy on my soul,’ Tom thought to himself. He had been saved after a few mugs by the lady declaring that they needed to save enough for a proper feast when they could manage it.
The result was a nice buzz and an even cockier Jackalope as they left the table. Perhaps it was her time for some healing following that whole shit show. He had never seen her as distraught as she was at Hylsdal. Not to mention the expression on her face when Zarko had carried the body of the dead girl away after they landed.
Apparently, alcohol had at the very least helped her think about something else, as she was spouting funny stories and, of course, boasting about how amazing she had been in the battle. That had led to a hasty explanation about how Tom had let her borrow some of his power during the battle. He wasn’t entirely sure if any of the locals bought it, but they were way too polite to question the explanation though. Or possibly scared, or just didn’t care, he wasn’t quite sure.
Unkai had gone over Jackalope first and deemed her as fixed as she could be right now; he didn't dare try to fix her ears, claiming that to be way beyond him. He sounded confident that Nunuk might be able to put them back together again though. Jackalope let out an annoyed sigh at the news, though the part about Nunuk did help.
It was clear Jacky and Tom had received priority when it came to getting fixed up after the battle. Unkai had put in some work on Tom, mainly putting his effort into the stinger wound on his side. Tom had him check his neck wound as thoroughly as he could manage. But Unkai claimed that was as good as it was going to get, though he recommended some resting time.
“Fuck, I took painkillers earlier,” Tom let out as Unkai touched the stinger wound, which didn’t hurt as much as it should have.
“Is that bad?” Unkai had questioned, looking at the wound.
“I drank alcohol too, you're not supposed to mix those.” Unkai looked at Tom as if he was expecting more than that.
“Well don’t look at me, I don’t know how they work,” he finally responded, Jackalope’s face growing worried at the exchange, her gaze breaking as she looked to Unkai.
“He’s fine, right? He’s been stung before. He’s tough on that front even if his skin is soft like a kid’s,” She asked with worry in her voice slurring slightly, Tom taking slight offense at the last part. Unkai turned to her, giving her a thumbs up and a smile before looking back at the wound.
“Anything we can do about it?” the healer questioned, clearly trying to not look worried this time, for Jacky’s sake.
“Don’t think so. I guess I’m just gonna cross my fingers and wait it out,” Tom answered truthfully. He had no clue what the actual effect of that might be. He felt fine though. He was a little weird in the head, but that was honestly to be expected in his current condition.
“Well I don’t think you’re gonna be sleeping alone anyway, but consider it medical advice to have someone look after you,” Unkai replied trying a sly smile, which just looked wrong on him.
“Tom the hot stone reporting for duty,” Tom joked back as Unkai went about reapplying the bandage to the wound. Jacky’s gaze switching back to Tom seemingly excited, the edges of her mouth curling into a slight smile.
The young woman who had washed his clothes earlier had shown them up to the bedrooms after the quick check-up.
“We have a few rooms which weren’t in use before, don’t worry it’s not… someones. I'm sorry if they are dirty, but you can have one each if you want.” She sounded really rather uncomfortable. Tom could get why. He could see the number of rooms and there had to be at least a few that had owners until recently.
“This is very kind of you. Thank you,” Tom replied, the woman giving a curtsy before making her way back down the stairs rather hurriedly. Tom got out the notepad to ask Jacky if she wanted to share a room. Thinking back, that wasn’t at all necessary; he just felt like it was the right thing to at least ask.
Jackalope though didn’t bother to ask him. Taking him by the wrist rather firmly, she led him into the first room the young woman had shown them.
​
The Pancake Chapter: Pancake!
__________________________________________________________________________________
Balethon now safely in her grasp, Sapphire circled back the way she came. She almost wanted to tell him to enjoy this since she was likely not gonna be carrying him again, not to mention at night in nothing but her underwear. The dude had already had a remarkably shitty night though, so she refrained.
She spotted the large disorganized group which had been supposed to keep the tavern safe. They had set down in a square and were looking around confused as Sapphire came in to land. She was quickly greeted by a near-hysterical Haiko who looked ready to drop his mace as he nearly trod on Balethon in an attempt to hug her faster.
“You’re okay, right? Nothing wrong?”
“I’m fine, the bastards couldn’t shoot.”
“Oh thank whoever cared,” he let out, squeezing her tightly.
“Where is Dakota?” Sapphire squeaked out from his embrace. He let go of her taking a step back looking around.
“Not here. Neither is that Maiko guy, and he damn near caught up to you before you shot off into the darkness. You haven't gotten any slower, have you now?”
“Not by much, no,” she replied, looking down to her stricken cargo. “Let’s get him to sit up somewhere. Any of you got some water?” she questioned, looking to the other guards. Her eyes landed on someone being bound up. She assumed it was the mercenary who had tried to attack her. “You're a shit fighter, I hope you know that,” She shouted out, glaring at the arsehole, who just stared at her with clear contempt.
Draki had come over with a canteen of water, looking up to Sapphire and looking a bit strained in the face before he turned to Haiko.
“I owe you two silver, don’t I?” the diminutive guy asked, seeming rather annoyed.
“I told you, she’s the fastest woman you ever saw,” Haiko replied with a smile, trying to fold out Balethon, eventually giving up. “Grab on, let’s put him on that bench over there,” he went, grabbing Balethon by the legs, with Sapphire taking the shoulders as they carried him over. He was stiff as a board, though the panicked look in his eyes was at least sort of gone.
“You put a bet on me catching them?” Sapphire questioned as set him down. She wasn’t sure if she should be flattered or angry. Haiko held up his hands defensively, shaking his head.
“No no, Draki just didn’t believe all the stories, so I put two silver on the stories being true. Easiest bet ever.” That was more to Sapphire’s liking, and she gave him a slightly wicked smile. “You know we used to get a slice of the bets back then.”
“Hey, I got you your own personal protection service,” He replied, gesturing to the motley collection of dragonettes mulling about the square.
“That’s a word for it, I guess,” Sapphire replied, not overly impressed. It wasn’t like they had done much good tonight. “Take good care of him, I have some questions,” she went, leaving Haiko and going over to the now thoroughly tied up dragonette who had attacked her, the questioning already underway. Someone let out a suggestive growl as she walked by. The fact that she was wearing nothing but her underpants in the middle of the street dawning on her.
“Do that again and I’ll kill you,” she snarled, not sure who the offending member was, before turning her attention to the mercenary. “So… You thought kidnapping one of my friends was a good idea? How well would you say that went?” She questioned looking down at the piece of shit.
“Fucking brilliantly,” he responded angrily. “I ended up with a nice view if nothing else,” he continued with a shit-eating grin.
“How hard may I punch him?” She demanded, looking around at the guards. Most of them just looked confused at each other.
“As hard as I say so,” Maiko bellowed out, coming down alongside Dakota, who was carrying a very large unconscious female dragonette with an arrow sticking out of her back.
“Not your best shot, but it did the trick,” Dakota let out, unceremoniously dumping the dragonette on the ground before setting down. “Tie her up too, she won’t be out forever.”
After a bit they got the both of them tied up at about the same time as a contingent of city guards arrived, demanding to know what was going on. Sapphire cursed the fact she likely wouldn’t be allowed to beat the shit out of them now, as they began asking some very pointed questions.
“Oh yeah sure, a group of armed what was it... Tavern guards? Out at night with a pair of half-naked women and a dude who claims to be Royal Guard. And why has she been shot?!” the lead city guard questioned, looking around at them.
“Because she kidnapped him after stabbing him with vargulf poison,” Sapphire let out, wide armed. “How the fuck is that hard to understand!?”
“Calm down woman, who shot her?” the man questioned pointing at the female mercenary.
“I did and two other pieces of shit who tried to kill us!”
“Right, you're all coming with us. We need to know what happened here. Manacles,” the City Guard replied, snapping his fingers over his shoulder and receiving the item in question. Sapphire’s heart sank; she had never been arrested before. Closest she had ever gotten was being given a stern talking to for sneaking into the training fields.
Dakota looked ready with a reply, when Maiko beat her to it.
“Listen up you little shit-eating ground rat, see what this is?!” He went, holding up his sword, which true to form bore the royal insignia on the crossguard. “I will make a cape out of your fucking wings if you don’t man up and do your fucking job. These bastards attacked a tavern in the middle of the night, attempted murder, managed a kidnapping, then had a go at murder again during the desperate chase to catch them and your useless ass turns up just in time to insult the Royal Guard and be useless.”
“I’m gonna have to ask you to...” the city guard attempted to protest, though seemingly with a growing sense of apprehension.
“No, you may not. You are outranked! Or do I need to get the colonel to inform her the city guard is aiding an enemy of the crown? That would lead to some serious fucking cleansing of your unit, I can assure you of that!”
“In that case, I say we take you to the stockade and send for this colonel of yours, perhaps letting her know someone stole a blade from the Royal Guard armories.” Sapphire expected Maiko to explode at that insult, though he just pulled back with an evil smile.
“Very good sir, let’s go. Though I would appreciate the opportunity to get my uniform before appearing before my superior. You may escort me to the tavern in question if you wish.”
“That can be arranged, I assume you two wouldn’t mind getting dressed either, though I must insist on you accompanying us. Don’t we have a blanket or something?” he asked, looking back to his unit, eventually procuring a pair of thin woolen blankets.
“Bloody brilliant sir, how exactly do we fly with these?” Dakota questioned sounding very unimpressed.
“Uhm…”
As they were getting ready for takeoff Sapphire heard someone get a smack to the back of the head as she moved to check up on Balethon. Looking back, a slightly ashamed looking tavern guard was rubbing the back of his head, a very unimpressed woman standing next to him. ‘God fucking dammit’ she cursed to herself.
The ones who had woken up in the middle of the night broke off, going back to the tavern to get dressed in preparation for a long night. They wanted the bastards interrogated immediately anyway, even if getting interrogated themselves hadn't really been the plan. If this was the work of the Flaxens they would be doing their best to cover their tracks as soon as they learned of the mission's failure, so speed was of the essence.
“Why can’t we just be left in peace!” Dakota snapped as they were getting dressed. “Please let it just be the Flaxens so we can get them dealt with already.”
“Of course it’s them, who else could it be?” Sapphire dismissed her as she strapped on her greaves. Sapphire had a feeling Colonel Hashaw would not take kindly to this attack so she was bound to be there, therefore she needed to look proper in case they got fine company at the stockade.
Maiko had gone on to the Hashaw Estate to report back on the evening’s activities and hopefully convince Victoria to make an appearance. So Sapphire and Dakota found themselves standing in front of the stockade with a city guard escort.
It was a large, ugly building, looking like a place you wanted to avoid at all costs with its rough grey stone and metal barred cell windows lining the walls. “May they rot in here forever,” Sapphire let out as they were shown inside. She and Dakota were taken to different interrogation rooms. They were civil about it though, not even tying her up like she had feared.
The guy who had ‘caught them’ as he claimed was apparently in charge of this case. He formally introduced himself as Sergeant Lanok and set about asking questions, not many of which were intelligent. Where they were from, what they were doing here, why they had an armed escort in the middle of the night despite not even being properly dressed at the time.
He of course didn't believe most of the answers he was getting. Especially the part about being in the employ of the king at the moment, nor the whole Flaxen situation.
“What? You claim to be the target of a kidnapping attempt by a noble family, one on the council at that?! Give me a break,” Sapphire had to fight really hard not to slap him, but she didn’t want to end up in manacles, so she just stared at him contemptuously. Then there was a deep thunk that shook the building followed by creaking wood from above.
“This should be good,” Sapphire let out, leaning back with a smirk, relishing in the confusion on the guy’s face.
It took a bit longer than Sapphire had anticipated, as she refused to answer further questions, but there was eventually a knock on the door, Sergeant Lanok getting up to answer it. He was confronted by a very pissed looking Colonel Hashaw in formal uniform, Maiko and Yilditz at her back.
“You seem to have attempted to arrest one of my men and two people you really shouldn’t have. Not to mention waking both me and a decidedly grumpy 10 ton black dragon currently on your roof.”
‘So it wasn’t Baron then,’ Sapphire concluded. She doubted very much he could have been roused for this anyway, it also made sense to bring a black, they liked the night anyway. Maiko had been decent at laying out a string of insults, but Hashaw was clearly the source of his talent, as she chewed out not only the sergeant but anyone dumb enough to make an objection or not make themselves as small as they could including the captain of the Stockade much to Sapphire's horror.
It definitely helped that she was flanked by Ylditz, the person who had been tasked with finding out who the mercenaries were, as well as a few other family members. The dragon in question was apparently Tiguan, one of Jarix's training buddies. Sapphire guessed he was here just as much for a bit of experience then.
“Is there anyone dumb or useless enough in here to have anything more to say...? Very good. Where are the two who ‘actually’ need questioning?”
The tavern guards had been allowed to go, though Haiko had stuck around. The Sergeant was now looking very small as he took them to the room where the one who hadn’t been shot was sitting. The woman who had been carrying Balethon currently being treated.
“Do you have even the slightest idea how much you fucked up tonight?” Hashaw asked as she strode in the door, the sergeant holding it open for her.
“Pretty fucking badly I presume, but what the hell are you gonna do, huh? Gonna execute me, perhaps clip my wings? Doesn't matter if you’re Royal Guard or tavern guard the punishment is the same. So you don’t scare me woman or should I say… oh, Colonel, wow I really did fuck up, huh?” Well, Sapphire had to give it to him, he was taking the news that he was likely done for rather well, or perhaps he was just in denial about the whole thing.
“Oh, I can do worse than that I think. Sapphire, you wouldn’t happen to have learned a thing or two from our friend?”
“Might have done,” she admitted, thinking back to what she could remember of Tom’s escapades.
“Sergeant, what is the punishment for his crimes?”
“Well, he failed to kill anyone, hence he is charged with attempted murder and attempted kidnapping. So indentured servitude for quite a while. Unless he could pay for a prison sentence of course.”
“Right then, how about this? Tell me who sent you and I will pay for your prison time,” the colonel then went, looking to the perp. “I know you were hired to do this, so while you may be a piece of shit it’s not you that I want. Alternatively, I could start pulling strings until we get some alone time with you and make your life really fucking unpleasant.”
Sapphire looked slightly nervously to the sergeant, but he was still cowering, so she guessed Hashaw got away with threatening to break the law inside the stockade. It was a generous offer too. If this guy was going away for a long time, paying for it wasn’t gonna be cheap.
“You know my choice is death or slavery here. You can’t be dumb enough to believe they will let me live if I talk.”
“That depends on who sent you, because if it is who I think it is they won't be around to send someone to kill you after this.” Again Sapphire was fairly sure they couldn't condemn the entire Flaxen family for something like this, but hey if it works it works.
“You seriously think we take jobs directly? It’s not the client that will kill me dipshit. My boss would.” Hashaw was very clearly not pleased with that answer, as she turned to the sergeant.
“Would you agree this man is guilty, on the word of both independent tavern guards, the Royal Guard, and our two huntresses of the noble Bizmati Keep? Or do you insist on a mock trial for this piece of shit?”
The sergeant looked a tad bewildered for a second before nodding. “Yes ma’am. I’ll have him sent off to the deepest mine I can find tomorrow.”
“No, I want him handed over to the Royal Guard so we may question him as an enemy combatant.”
“You cannot do that and you know it,” the sergeant replied, finally standing up for himself. Clearly to Hashaw’s great annoyance.
“Then I want you to get me a telepath. Am I correct in assuming his rights on that matter are no longer in place even if I can’t pull his claws out?”
“Yes, but we don’t have one, ma’am. You must understand, a criminal’s mind is not exactly the kindest place to be.”
“Weak-minded cowards,” Hashaw cursed, looking away pondering. “Fine keep him here, you may continue with your excuse for questioning. I’ll be back, luckily not everyone is as weak of spine.”
__________________________________________________________________________________
So then We have prisoners to work with once again. hopefully, they will fare a little better than the last one. then again... Maybe not. As always do let me know what you thought down below be it good bad or just generally hilarious.
until next time, have an awesome day.
​
ko-fi For having more pretty pictures commissioned.
Sapphire
Wiki Discord
First Previous Next
Just in case you missed it, the pancake chapter: Pancake!

I was invited by one of the mods to share this here as a mega thread, so here goes...
Edit - apparently this saga was so long that I had to split it into two parts. This is part 5-8.
​
Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts.
Part 5:
IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division.
These are people with arrest power, by the way. And yeah, that's important later in the day.
When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence.
Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it. Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV.
Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN.
Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well.
I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better.
My friend came over and told me he had something to show me.
He pulled out his phone, and gave me an absolute shit-eating grin.
He made me wait for it.
It was worth it.
Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk.
I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV.
Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent". Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper.
And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house.
With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS).
I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV. She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!"
My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard.
I couldn't help myself. I smiled, and waved.
She flipped me off, turned on her heel, and stomped away.
I've had a permanent grin the rest of the day.
PART 6:
Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally.
As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.).
As I mentioned in the comments in part 5, the Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points.
So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence. Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof.
Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face. I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with. Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name. Again, lots of conjecture, but nothing that could be entered into evidence in court.
Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "stragetic lawsuit against public participation". You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights.
So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something. I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system. I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced".
This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week).
During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece. She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace.
"Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution. Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]." (This is not an exact quote, I may update it if I get a copy of the court transcripts.)
As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best.
We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away.
At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon. At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time. That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt.
Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away. They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit.
My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to squeeze water from a stone get paid myself. Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows.
My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her. Just for grins... Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit.
Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home. So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth. So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate (yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES".
Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank..
I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner.
PART 7 (TAZERS!):
So with the Coronavirus fun and excitement that everyone has been having, most of the courts in our area have slowed way down. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate.
We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle). So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy coming stumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell?
If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a pistol and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt. I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door.
Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the ass. And it did give me a front row seat for the shenanigans that were about to follow.
I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud.
I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything. This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just kill myself right here right now and maybe you'd be happy with that too!".
Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself). So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone.
She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general. It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands.
Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more.
Two steps.
Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her. She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point.
The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the COVID issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date. So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence.
Whoopsie.
As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked. Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified.
I do believe she has picked that shovel back up and dug her hole that much deeper.
PART 7b:
Well, someone messaged me asking for an update - I'll keep it brief:
She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses. She made it abundantly clear that if it weren't for the current mess with COVID, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours. A quick look at google maps and we had our answer "75 feet, your honor". The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time. The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying.
The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe - again once this COVID mess is over.
I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through. Plus the possibilities of appeals, etc.
Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :)
PART 8 - THE END?:
But first, the obligatory TL;DR:
President of a fake HOA is a bitch to my wife. Gets sued, loses her husband, career, car, and house. She tries to sue me and loses. Decides to get drunk and belligerent, gets tazed. And now is convicted of multiple counts of fraud (misdemeanor and felony) plus a bunch more lawsuits filed.
So a slightly longer summary is that when my wife and I bought our home, we were very specific in avoiding HOA's. After moving in, we met the "president of the HOA" behind our house. AT FIRST, she seemed nice enough, but little did we know the insanity that was going to come out of her. So we hired an arborist to take down a hazardous limb from a tree, and weren't able to move the wood onto our property the day of since he finished late and I was heading out of town the next day. The psychopath decided to freak out on my wife, until she browbeat her into moving these wood rounds (some weighing in excess of 100 lbs) by herself. They were stacked neatly, out of the way, and in no way an impediment to foot traffic. She claimed that the area that the rounds were stacked on was private property of the HOA (turns out it wasn't!) and that it needed to be moved immediately.
Well, some time later, some hedges that were growing on the "HOA's private property" pushed over a section of our wooden fence. E-mailed her, and the short version of her reply was that it wasn't their property and wasn't their hedges so we were SOL on getting our fence fixed by them. Waitwhut?
This kicked off a couple of weeks of calling a multitude of county departments to find out who actually owned that chunk of land. Eventually learn that it is actually county property as part of the right-of-way that was ceded to the county for a road. And the reason it took so long to figure this out was that there *was* no HOA registered with the county. So I sent an anonymous letter to everyone in the "HOA" with what I had found out.
Cue everyone in the fake HOA suing her ass for fraud.
Her husband, who was not in on the scam, promptly files for divorce - he wants absolutely no part in this.
IRS and state revenue agency start crawling up her ass for back taxes.
She was a real estate agent and principal broker. Those licenses were revoked by the state. She loses her job.
House goes up for sale, it's listed for abut 15% higher than comps and it's still a short sale - so she's in deep trouble financially.
She gets arrested for interfering with the duties of a federal agent when the IRS comes knockin - and they seize her brand new Mercedes SUV to boot.
Tries to sue me, loses badly, and has to pay my costs and attorneys fees, and I file for a protective order because she's crazy.
Gets drunk and belligerent, violates protective order. Gets tazed by the county mounties for her troubles. Jail again. Stronger restraining order.
That all brings us to the beginning of this final update....
Due to COVID, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case. Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony. I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package.
So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them.
The prosecutor then had to get his last jab in, "So Mr. AmbulanceDriver2, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her?
"What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood."
I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies. I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart. There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated.
Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on.
And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify.
I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far. But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims. Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits. I suspect that number has grown since then.
I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.